99
|
Revvity
ivis spectrum in vivo imaging system Ivis Spectrum In Vivo Imaging System, supplied by Revvity, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ivis spectrum in vivo imaging system/product/Revvity Average 99 stars, based on 1 article reviews
ivis spectrum in vivo imaging system - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
99
|
Thermo Fisher
housekeeping gene glyceraldehyde 3 phosphate dehydrogenase Housekeeping Gene Glyceraldehyde 3 Phosphate Dehydrogenase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/housekeeping gene glyceraldehyde 3 phosphate dehydrogenase/product/Thermo Fisher Average 99 stars, based on 1 article reviews
housekeeping gene glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
92
|
Bethyl
a302 545a rrid ab 1999012  A302 545a Rrid Ab 1999012, supplied by Bethyl, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a302 545a rrid ab 1999012/product/Bethyl Average 92 stars, based on 1 article reviews
a302 545a rrid ab 1999012 - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
graphpad prime5 Graphpad Prime5, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad prime5/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad prime5 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prim software Prim Software, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prim software/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prim software - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
ec 20 /ec 50 values Ec 20 /Ec 50 Values, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ec 20 /ec 50 values/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
ec 20 /ec 50 values - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
nonlinear regression graphpad prim 5.0 Nonlinear Regression Graphpad Prim 5.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nonlinear regression graphpad prim 5.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
nonlinear regression graphpad prim 5.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
93
|
GE Healthcare
probequant g 50 micro columns Probequant G 50 Micro Columns, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/probequant g 50 micro columns/product/GE Healthcare Average 93 stars, based on 1 article reviews
probequant g 50 micro columns - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
90
|
psychology software tools
e-prime software version 2.0 E Prime Software Version 2.0, supplied by psychology software tools, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e-prime software version 2.0/product/psychology software tools Average 90 stars, based on 1 article reviews
e-prime software version 2.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
mouse cyclin d2-sense (50-gcgtgcagaaggacatcca-30) Mouse Cyclin D2 Sense (50 Gcgtgcagaaggacatcca 30), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse cyclin d2-sense (50-gcgtgcagaaggacatcca-30)/product/Thermo Fisher Average 90 stars, based on 1 article reviews
mouse cyclin d2-sense (50-gcgtgcagaaggacatcca-30) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
92
|
OriGene
gttcccgcattatctccatccg 30 origene Gttcccgcattatctccatccg 30 Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gttcccgcattatctccatccg 30 origene/product/OriGene Average 92 stars, based on 1 article reviews
gttcccgcattatctccatccg 30 origene - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
90
|
AUTODOCK GmbH
vina 1.1.2 software Vina 1.1.2 Software, supplied by AUTODOCK GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vina 1.1.2 software/product/AUTODOCK GmbH Average 90 stars, based on 1 article reviews
vina 1.1.2 software - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Reports
Article Title: The N-terminal domain of SARS-CoV-2 nsp1 plays key roles in suppression of cellular gene expression and preservation of viral gene expression
doi: 10.1016/j.celrep.2021.109841
Figure Lengend Snippet:
Article Snippet: Rabbit anit-RACK1 ,
Techniques: Magnetic Beads, Recombinant, Protease Inhibitor, Transfection, Luciferase, SYBR Green Assay, Primer Extension Assay, Clone Assay, Software